Antibodies
Anti-CD172a/SIRPα Antibody-Oligo Conjugate
SKU: aoc1500
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-CD172a/SIRPα Antibody-IF1
Antibody Target
- Target
- Tyrosine-protein phosphatase non-receptor type substrate 1
- UniProt Number
- P78324
- Target Description
- Immunoglobulin-like cell surface receptor for CD47. Acts as docking protein and induces translocation of PTPN6, PTPN11 and other binding partners from the cytosol to the plasma membrane. Supports adhesion of cerebellar neurons, neurite outgrowth and glial cell attachment. May play a key role in intracellular signaling during synaptogenesis and in synaptic function. Involved in the negative regulation of receptor tyrosine kinase-coupled cellular responses induced by cell adhesion, growth factors or insulin. Mediates negative regulation of phagocytosis, mast cell activation and dendritic cell activation. CD47 binding prevents maturation of immature dendritic cells and inhibits cytokine production by mature dendritic cells. Plays a role in antiviral immunity and limits new world arenavirus infection by decreasing virus internalization. Receptor for THBS1. Interaction with THBS1 stimulates phosphorylation of SIRPA. In response to THBS1, involved in ROS signaling in non-phagocytic cells, stimulating NADPH oxidase-derived ROS production.
- Molecular Weight
- 55kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC1626
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat