Antibodies
Anti-CD177 Antibody-Oligo Conjugate (ARC62893)
SKU: aoc1502
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-CD177 Antibody (ARC62893)-IF1
Antibody Target
- Target
- CD177 antigen
- UniProt Number
- Q8N6Q3
- Target Description
- In association with beta-2 integrin heterodimer ITGAM/CD11b and ITGB2/CD18, mediates activation of TNF-alpha primed neutrophils including degranulation and superoxide production (PubMed:21193407). In addition, by preventing beta-2 integrin internalization and attenuating chemokine signaling favors adhesion over migration (PubMed:28807980). Heterophilic interaction with PECAM1 on endothelial cells plays a role in neutrophil transendothelial migration in vitro (PubMed:17580308). However, appears to be dispensable for neutrophil recruitment caused by bacterial infection in vivo (PubMed:23461681). Acts as a receptor for the mature form of protease PRTN3 allowing its display at the cell surface of neutrophils (PubMed:17244676, PubMed:18462208). By displaying PRTN3 at the neutrophil cell surface, may play a role in enhancing endothelial cell junctional integrity and thus vascular integrity during neutrophil diapedesis (PubMed:23202369)..
- Molecular Weight
- 51kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC62893
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human