Antibodies
Anti-CD18 Antibody-Oligo Conjugate
SKU: aoc1503
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-CD18 Antibody-IF1
Antibody Target
- Target
- Integrin beta-2
- UniProt Number
- P05107
- Target Description
- Integrin ITGAL/ITGB2 is a receptor for ICAM1, ICAM2, ICAM3 and ICAM4. Integrin ITGAL/ITGB2 is also a receptor for the secreted form of ubiquitin-like protein ISG15; the interaction is mediated by ITGAL. Integrins ITGAM/ITGB2 and ITGAX/ITGB2 are receptors for the iC3b fragment of the third complement component and for fibrinogen. Integrin ITGAX/ITGB2 recognizes the sequence G-P-R in fibrinogen alpha-chain. Integrin ITGAM/ITGB2 recognizes P1 and P2 peptides of fibrinogen gamma chain. Integrin ITGAM/ITGB2 is also a receptor for factor X. Integrin ITGAD/ITGB2 is a receptor for ICAM3 and VCAM1. Contributes to natural killer cell cytotoxicity. Involved in leukocyte adhesion and transmigration of leukocytes including T-cells and neutrophils. Triggers neutrophil transmigration during lung injury through PTK2B/PYK2-mediated activation. Integrin ITGAL/ITGB2 in association with ICAM3, contributes to apoptotic neutrophil phagocytosis by macrophages. In association with alpha subunit ITGAM/CD11b, required for CD177-PRTN3-mediated activation of TNF primed neutrophils.
- Molecular Weight
- 85kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIF-PIHCELISA
- Clone
- ARC67171
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat