Antibodies
Anti-CD19 Antibody-Oligo Conjugate
SKU: aoc1504
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-CD19 Antibody-IF1
Antibody Target
- Target
- B-lymphocyte antigen CD19
- UniProt Number
- P15391
- Target Description
- Functions as a coreceptor for the B-cell antigen receptor complex (BCR) on B-lymphocytes. Decreases the threshold for activation of downstream signaling pathways and for triggering B-cell responses to antigens. Activates signaling pathways that lead to the activation of phosphatidylinositol 3-kinase and the mobilization of intracellular Ca(2+) stores. Is not required for early steps during B cell differentiation in the blood marrow. Required for normal differentiation of B-1 cells. Required for normal B cell differentiation and proliferation in response to antigen challenges. Required for normal levels of serum immunoglobulins, and for production of high-affinity antibodies in response to antigen challenge.
- Molecular Weight
- 61kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIF-PIHCELISA
- Clone
- ARC0418
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanCynomolgus monkey