Antibodies
Anti-CD209 Antibody-Oligo Conjugate
SKU: aoc1515
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-CD209 Antibody-IF1
Antibody Target
- Target
- CD209 antigen
- UniProt Number
- Q9NNX6
- Target Description
- Pathogen-recognition receptor expressed on the surface of immature dendritic cells (DCs) and involved in initiation of primary immune response. Thought to mediate the endocytosis of pathogens which are subsequently degraded in lysosomal compartments. The receptor returns to the cell membrane surface and the pathogen-derived antigens are presented to resting T-cells via MHC class II proteins to initiate the adaptive immune response.; FUNCTION: On DCs it is a high affinity receptor for ICAM2 and ICAM3 by binding to mannose-like carbohydrates. May act as a DC rolling receptor that mediates transendothelial migration of DC presursors from blood to tissues by binding endothelial ICAM2. Seems to regulate DC-induced T-cell proliferation by binding to ICAM3 on T-cells in the immunological synapse formed between DC and T-cells.; FUNCTION: (Microbial infection) Acts as an attachment receptor for HIV-1 and HIV-2.; FUNCTION: (Microbial infection) Acts as an attachment receptor for Ebolavirus.; FUNCTION: (Microbial infection) Acts as an attachment receptor for Cytomegalovirus.; FUNCTION: (Microbial infection) Acts as an attachment receptor for HCV.; FUNCTION: (Microbial infection) Acts as an attachment receptor for Dengue virus.; FUNCTION: (Microbial infection) Acts as an attachment receptor for Measles virus.; FUNCTION: (Microbial infection) Acts as an attachment receptor for Herpes simplex virus 1.; FUNCTION: (Microbial infection) Acts as an attachment receptor for Influenzavirus A.; FUNCTION: (Microbial infection) Acts as an attachment receptor for SARS-CoV.; FUNCTION: (Microbial infection) Acts as an attachment receptor for Japanese encephalitis virus.; FUNCTION: (Microbial infection) Acts as an attachment receptor for Lassa virus. Acts as an attachment receptor for Marburg virusn.; FUNCTION: (Microbial infection) Acts as an attachment receptor for Respiratory syncytial virus.; FUNCTION: (Microbial infection) Acts as an attachment receptor for Rift valley fever virus and uukuniemi virus.; FUNCTION: (Microbial infection) Acts as an attachment receptor for West-nile virus.; FUNCTION: (Microbial infection) Probably recognizes in a calcium-dependent manner high mannose N-linked oligosaccharides in a variety of bacterial pathogen antigens, including Leishmania pifanoi LPG, Lewis-x antigen in Helicobacter pylori LPS, mannose in Klebsiella pneumonae LPS, di-mannose and tri-mannose in Mycobacterium tuberculosis ManLAM and Lewis-x antigen in Schistosoma mansoni SEA. Recognition of M.tuberculosis by dendritic cells occurs partially via this molecule.
- Molecular Weight
- 46 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC1679
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat