Antibodies
Anti-CD22 Antibody-Oligo Conjugate
SKU: aoc1520
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-CD22 Antibody-IF1
Antibody Target
- Target
- B-cell receptor CD22
- UniProt Number
- P20273
- Additional Target Information
- This antibody also binds B-cell receptor CD22, Uniprot:P35329.
- Target Description
- Most highly expressed siglec (sialic acid-binding immunoglobulin-like lectin) on B-cells that plays a role in various aspects of B-cell biology including differentiation, antigen presentation, and trafficking to bone marrow. Binds to alpha 2,6-linked sialic acid residues of surface molecules such as CD22 itself, CD45 and IgM in a cis configuration. Can also bind to ligands on other cells as an adhesion molecule in a trans configuration. Acts as an inhibitory coreceptor on the surface of B-cells and inhibits B-cell receptor induced signaling, characterized by inhibition of the calcium mobilization and cellular activation. Mechanistically, the immunoreceptor tyrosine-based inhibitory motif domain is phosphorylated by the Src kinase LYN, which in turn leads to the recruitment of the protein tyrosine phosphatase 1/PTPN6, leading to the negative regulation of BCR signaling. If this negative signaling from is of sufficient strength, apoptosis of the B-cell can be induced.
- Molecular Weight
- 95kDa/97kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIF-PIHCELISA
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human/Mouse
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse