Antibodies
Anti-CD26 Antibody-Oligo Conjugate (ARC59223)
SKU: aoc1526
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Proximity Ligation Assay Oligossee protocol
PLA1 Oligo Details
5'
[AmC6dT] ACAACAACAAGAATGGAACCTCGCTAGAACGT
3'
An AOC with the PLA2 oligo is needed to complete the pairing in a Proximity Ligation Assay.
Anti-CD26 Antibody (ARC59223)-PLA1
Antibody Target
- Target
- Dipeptidyl peptidase 4
- UniProt Number
- P27487
- Target Description
- Cell surface glycoprotein receptor involved in the costimulatory signal essential for T-cell receptor (TCR)-mediated T-cell activation. Acts as a positive regulator of T-cell coactivation, by binding at least ADA, CAV1, IGF2R, and PTPRC. Its binding to CAV1 and CARD11 induces T-cell proliferation and NF-kappa-B activation in a T-cell receptor/CD3-dependent manner. Its interaction with ADA also regulates lymphocyte-epithelial cell adhesion. In association with FAP is involved in the pericellular proteolysis of the extracellular matrix (ECM), the migration and invasion of endothelial cells into the ECM. May be involved in the promotion of lymphatic endothelial cells adhesion, migration and tube formation. When overexpressed, enhanced cell proliferation, a process inhibited by GPC3. Also acts as a serine exopeptidase with a dipeptidyl peptidase activity that regulates various physiological processes by cleaving peptides in the circulation, including many chemokines, mitogenic growth factors, neuropeptides and peptide hormones such as brain natriuretic peptide 32. Removes N-terminal dipeptides sequentially from polypeptides having unsubstituted N-termini provided that the penultimate residue is proline.; FUNCTION: (Microbial infection) Acts as a receptor for human coronavirus MERS-CoV-2.
- Molecular Weight
- 88kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIPFlow CytometryELISA
- Clone
- ARC59223
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human