Antibodies
Anti-CD3 Antibody-Oligo Conjugate (ARC68274)
SKU: aoc1532
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-CD3 Antibody (ARC68274)-IF1
Antibody Target
- Target
- T-cell surface glycoprotein CD3 epsilon chain
- UniProt Number
- P07766
- Target Description
- Part of the TCR-CD3 complex present on T-lymphocyte cell surface that plays an essential role in adaptive immune response. When antigen presenting cells (APCs) activate T-cell receptor (TCR), TCR-mediated signals are transmitted across the cell membrane by the CD3 chains CD3D, CD3E, CD3G and CD3Z. All CD3 chains contain immunoreceptor tyrosine-based activation motifs (ITAMs) in their cytoplasmic domain. Upon TCR engagement, these motifs become phosphorylated by Src family protein tyrosine kinases LCK and FYN, resulting in the activation of downstream signaling pathways (PubMed:2470098). In addition of this role of signal transduction in T-cell activation, CD3E plays an essential role in correct T-cell development. Initiates the TCR-CD3 complex assembly by forming the two heterodimers CD3D/CD3E and CD3G/CD3E. Also participates in internalization and cell surface down-regulation of TCR-CD3 complexes via endocytosis sequences present in CD3E cytosolic region (PubMed:10384095, PubMed:26507128). In addition to its role as a TCR coreceptor, it serves as a receptor for ITPRIPL1. Ligand recognition inhibits T-cell activation by promoting interaction with NCK1, which prevents CD3E-ZAP70 interaction and blocks the ERK-NFkB signaling cascade and calcium influx (PubMed:38614099)..
- Molecular Weight
- 23kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIF-PIHCFlow CytometryELISA
- Clone
- ARC68274
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human