Antibodies
Anti-CD38 Antibody-Oligo Conjugate
SKU: aoc1547
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-CD38 Antibody-IF1
Antibody Target
- Target
- ADP-ribosyl cyclase/cyclic ADP-ribose hydrolase 1
- UniProt Number
- P28907
- Target Description
- Synthesizes cyclic ADP-ribose (cADPR), a second messenger for glucose-induced insulin secretion (PubMed:7961800, PubMed:8253715). Synthesizes the Ca(2+) mobilizer nicotinate-adenine dinucleotide phosphate, NAADP(+), from 2'-phospho-cADPR and nicotinic acid, as well as from NADP(+) and nicotinic acid. At both pH 5.0 and pH 7.4 preferentially transforms 2'-phospho-cADPR into NAADP(+), while preferentially cleaving NADP(+) to cADPR and ADPRP rather than into NADDP(+) (PubMed:16690024). Has cADPR hydrolase activity (PubMed:7961800, PubMed:8253715)..
- Molecular Weight
- 14 kDa/34 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCFlow CytometryELISA
- Clone
- ARC66212
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanCynomolgus monkey