Antibodies
Anti-CD43 Antibody-Oligo Conjugate
SKU: aoc1557
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-CD43 Antibody-IF1
Antibody Target
- Target
- Leukosialin
- UniProt Number
- P16150
- Target Description
- Predominant cell surface sialoprotein of leukocytes which regulates multiple T-cell functions, including T-cell activation, proliferation, differentiation, trafficking and migration. Positively regulates T-cell trafficking to lymph-nodes via its association with ERM proteins (EZR, RDX and MSN) (By similarity). Negatively regulates Th2 cell differentiation and predisposes the differentiation of T-cells towards a Th1 lineage commitment. Promotes the expression of IFN-gamma by T-cells during T-cell receptor (TCR) activation of naive cells and induces the expression of IFN-gamma by CD4(+) T-cells and to a lesser extent by CD8(+) T-cells (PubMed:18036228). Plays a role in preparing T-cells for cytokine sensing and differentiation into effector cells by inducing the expression of cytokine receptors IFNGR and IL4R, promoting IFNGR and IL4R signaling and by mediating the clustering of IFNGR with TCR (PubMed:24328034). Acts as a major E-selectin ligand responsible for Th17 cell rolling on activated vasculature and recruitment during inflammation. Mediates Th17 cells, but not Th1 cells, adhesion to E-selectin. Acts as a T-cell counter-receptor for SIGLEC1 (By similarity)..; FUNCTION: [CD43 cytoplasmic tail]: Protects cells from apoptotic signals, promoting cell survival..
- Molecular Weight
- 40kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC61321
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human