Antibodies
Anti-CD44 Antibody-Oligo Conjugate
SKU: aoc1558
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-CD44 Antibody-IF1
Antibody Target
- Target
- CD44 antigen
- UniProt Number
- P16070
- Target Description
- Cell-surface receptor that plays a role in cell-cell interactions, cell adhesion and migration, helping them to sense and respond to changes in the tissue microenvironment (PubMed:16541107, PubMed:19703720, PubMed:22726066). Participates thereby in a wide variety of cellular functions including the activation, recirculation and homing of T-lymphocytes, hematopoiesis, inflammation and response to bacterial infection (PubMed:7528188). Engages, through its ectodomain, extracellular matrix components such as hyaluronan/HA, collagen, growth factors, cytokines or proteases and serves as a platform for signal transduction by assembling, via its cytoplasmic domain, protein complexes containing receptor kinases and membrane proteases (PubMed:18757307, PubMed:23589287). Such effectors include PKN2, the RhoGTPases RAC1 and RHOA, Rho-kinases and phospholipase C that coordinate signaling pathways promoting calcium mobilization and actin-mediated cytoskeleton reorganization essential for cell migration and adhesion (PubMed:15123640)..
- Molecular Weight
- 82kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCFlow CytometryELISA
- Clone
- ARC52411
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human