Antibodies
Anti-CD5 Antibody-Oligo Conjugate (ARC1633)
SKU: aoc1567
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-CD5 Antibody (ARC1633)-IF1
Antibody Target
- Target
- T-cell surface glycoprotein CD5
- UniProt Number
- P06127
- Target Description
- Lymphoid-specific receptor expressed by all T-cells and in a subset of B-cells known as B1a cells. Plays a role in the regulation of TCR and BCR signaling, thymocyte selection, T-cell effector differentiation and immune tolerance. Acts by interacting with several ligands expressed on B-cells such as CD5L or CD72 and thereby plays an important role in contact-mediated, T-dependent B-cell activation and in the maintenance of regulatory T and B-cell homeostasis. Functions as a negative regulator of TCR signaling during thymocyte development by associating with several signaling proteins including LCK, CD3Z chain, PI3K or CBL (PubMed:1384049, PubMed:1385158). Mechanistically, co-engagement of CD3 with CD5 enhances phosphorylated CBL recruitment leading to increased VAV1 phosphorylation and degradation (PubMed:23376399). Modulates B-cell biology through ERK1/2 activation in a Ca(2+)-dependent pathway via the non-selective Ca(2+) channel TRPC1, leading to IL-10 production (PubMed:27499044)..
- Molecular Weight
- 55kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC1633
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human