Antibodies

Anti-CD66a/CEACAM1 Antibody-Oligo Conjugate

SKU: aoc1577

Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.

Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.

Choose AbOliGo for...

  • Consistent conjugation performance
  • Flexible antibody and oligo pairing
  • Fast conjugation turn around time
  • Trusted expertise in oligo design

Choose Oligo Conjugate

Assay

Immunofluorescence Oligossee protocol

IF1 Oligo Details

5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'

View Paper

Accessory oligo is complementary to only the ab-conjugated oligo

Anti-CD66a/CEACAM1 Antibody-IF1

Antibody Target

Target
Cell adhesion molecule CEACAM1
UniProt Number
P13688
Additional Target Information
This antibody also binds Cell adhesion molecule CEACAM1, Uniprot:P31809.
Target Description
[Isoform 1]: Cell adhesion protein that mediates homophilic cell adhesion in a calcium-independent manner. Plays a role as coinhibitory receptor in immune response, insulin action and also functions as an activator during angiogenesis. Its coinhibitory receptor function is phosphorylation- and PTPN6 -dependent, which in turn, suppress signal transduction of associated receptors by dephosphorylation of their downstream effectors. Plays a role in immune response, of T cells, natural killer (NK) and neutrophils. Upon TCR/CD3 complex stimulation, inhibits TCR-mediated cytotoxicity by blocking granule exocytosis by mediating homophilic binding to adjacent cells, allowing interaction with and phosphorylation by LCK and interaction with the TCR/CD3 complex which recruits PTPN6 resulting in dephosphorylation of CD247 and ZAP70. Also inhibits T cell proliferation and cytokine production through inhibition of JNK cascade and plays a crucial role in regulating autoimmunity and anti-tumor immunity by inhibiting T cell through its interaction with HAVCR2. Upon natural killer (NK) cells activation, inhibit KLRK1-mediated cytolysis of CEACAM1-bearing tumor cells by trans-homophilic interactions with CEACAM1 on the target cell and lead to cis-interaction between CEACAM1 and KLRK1, allowing PTPN6 recruitment and then VAV1 dephosphorylation. Upon neutrophils activation negatively regulates IL1B production by recruiting PTPN6 to a SYK-TLR4-CEACAM1 complex, that dephosphorylates SYK, reducing the production of reactive oxygen species (ROS) and lysosome disruption, which in turn, reduces the activity of the inflammasome. Down-regulates neutrophil production by acting as a coinhibitory receptor for CSF3R by down-regulating the CSF3R-STAT3 pathway through recruitment of PTPN6 that dephosphorylates CSF3R. Also regulates insulin action by promoting INS clearance and regulating lipogenesis in liver through regulating insulin signaling. Upon INS stimulation, undergoes phosphorylation by INSR leading to INS clearance by increasing receptor-mediated insulin endocytosis. This inernalization promotes interaction with FASN leading to receptor-mediated insulin degradation and to reduction of FASN activity leading to negative regulation of fatty acid synthesis. INSR-mediated phosphorylation also provokes a down-regulation of cell proliferation through SHC1 interaction resulting in decrease coupling of SHC1 to the MAPK3/ERK1-MAPK1/ERK2 and phosphatidylinositol 3-kinase pathways. Functions as activator in angiogenesis by promoting blood vessel remodeling through endothelial cell differentiation and migration and in arteriogenesis by increasing the number of collateral arteries and collateral vessel calibers after ischemia. Also regulates vascular permeability through the VEGFR2 signaling pathway resulting in control of nitric oxide production. Down-regulates cell growth in response to EGF through its interaction with SHC1 that mediates interaction with EGFR resulting in decrease coupling of SHC1 to the MAPK3/ERK1-MAPK1/ERK2 pathway. Negatively regulates platelet aggregation by decreasing platelet adhesion on type I collagen through the GPVI-FcRgamma complex. Inhibits cell migration and cell scattering through interaction with FLNA; interferes with the interaction of FLNA with RALA. Mediates bile acid transport activity in a phosphorylation dependent manner. Negatively regulates osteoclastogenesis.; FUNCTION: [Isoform 8]: Cell adhesion protein that mediates homophilic cell adhesion in a calcium-independent manner. Promotes populations of T cells regulating IgA production and secretion associated with control of the commensal microbiota and resistance to enteropathogens.
Molecular Weight
30kDa/37kDa/43kDa/46kDa/50kDa/57kDa

Antibody Characteristics

Clonality
Monoclonal
Application
WBICCIF-PIHCELISA
Isotype
IgG
Form
Liquid
Immunogen
Recombinant protein (or fragment).This information is considered to be commercially sensitive.
Immunogen Species
Human/Mouse
Host Species
Rabbit
Species Reactivity
HumanMouse