Antibodies
Anti-CD72 Antibody-Oligo Conjugate
SKU: aoc1585
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-CD72 Antibody-IF1
Antibody Target
- Target
- B-cell differentiation antigen CD72
- UniProt Number
- P21854
- Target Description
- Co-receptor of B cell receptor (BCR) that plays both positive and negative roles on B-cell functions. Recognizes the Sm/ribonucleoprotein (RNP) self-antigen ligand, and coligation of CD72 and BCR inhibits BCR signaling. Mechanistically, ligand binding leads to the recruitment of PTPN6/SHP-1 to the BCR complex which is inhibitory to BCR signaling. Also acts as a ligand for CD5 and thereby plays a critical role in maintaining regulatory T and B-cell homeostasis..
- Molecular Weight
- 40kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC62241
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human