Antibodies
Anti-CD73 Antibody-Oligo Conjugate
SKU: aoc1586
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-CD73 Antibody-IF1
Antibody Target
- Target
- 5'-nucleotidase
- UniProt Number
- P21589
- Target Description
- Catalyzes the hydrolysis of nucleotide monophosphates, releasing inorganic phosphate and the corresponding nucleoside, with AMP being the preferred substrate (PubMed:21933152, PubMed:22997138, PubMed:23142347, PubMed:24887587, PubMed:34403084). Shows a preference for ribonucleotide monophosphates over their equivalent deoxyribose forms (PubMed:34403084). Other substrates include IMP, UMP, GMP, CMP, dAMP, dCMP, dTMP, NAD and NMN (PubMed:21933152, PubMed:22997138, PubMed:23142347, PubMed:24887587, PubMed:34403084)..
- Molecular Weight
- 57kDa/63kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIF-PIHCELISA
- Clone
- ARC67101
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat