Antibodies
Anti-CD79a Antibody-Oligo Conjugate (ARC0482)
SKU: aoc1588
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-CD79a Antibody (ARC0482)-IF1
Antibody Target
- Target
- B-cell antigen receptor complex-associated protein alpha chain
- UniProt Number
- P11912
- Target Description
- Required in cooperation with CD79B for initiation of the signal transduction cascade activated by binding of antigen to the B-cell antigen receptor complex (BCR) which leads to internalization of the complex, trafficking to late endosomes and antigen presentation. Also required for BCR surface expression and for efficient differentiation of pro- and pre-B-cells. Stimulates SYK autophosphorylation and activation. Binds to BLNK, bringing BLNK into proximity with SYK and allowing SYK to phosphorylate BLNK. Also interacts with and increases activity of some Src-family tyrosine kinases. Represses BCR signaling during development of immature B-cells..
- Molecular Weight
- 25kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC0482
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human