Antibodies
Anti-CD82 Antibody-Oligo Conjugate
SKU: aoc1596
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-CD82 Antibody-IF1
Antibody Target
- Target
- CD82 antigen
- UniProt Number
- P27701
- Target Description
- Structural component of specialized membrane microdomains known as tetraspanin-enriched microdomains (TERMs), which act as platforms for receptor clustering and signaling. Participates thereby in diverse biological functions such as cell signal transduction, adhesion, migration and protein trafficking. Acts as a attenuator of EGF signaling, facilitating ligand-induced endocytosis of the receptor and its subsequent desensitization. Mechanistically, modulates ligand-induced ubiquitination and trafficking of EGFR via E3 ligase CBL phosphorylation by PKC. Increases cell-matrix adhesion by regulating the membrane organization of integrin alpha4/ITA4. Modulates adhesion and suppresses cell migration through other integrins such as the alpha6/ITGA6 and beta1/ITGB1. Decreases cell-associated plasminogen activation by interfering with the interaction between urokinase-type plasminogen activator/PLAU and its receptor PLAUR. Associates with CD4 or CD8 and delivers costimulatory signals for the TCR/CD3 pathway. Plays a role in TLR9 trafficking to acidified CpG-containing compartments by controlling interaction between TLR9 and VAMP3 and subsequent myddosome assembly. Inhibits LPS-induced inflammatory response by preventing binding of LPS to TLR4 on the cell surface. Plays a role in the activation of macrophages into anti-inflammatory phenotypes. Independently of Toll-like receptor (TLR) signaling, is recruited to pathogen-containing phagosomes prior to fusion with lysosomes and thereby participates in antigen presentation. Also acts to control angiogenesis and switch angiogenic milieu to quiescent state by binding and sequestering VEGFA and PDGFB to inhibit the signaling they trigger via their respective cell surface receptor.
- Molecular Weight
- 30kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIF-PIHCELISA
- Clone
- ARC1501
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse