Antibodies
Anti-CD86 Antibody-Oligo Conjugate
SKU: aoc1601
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-CD86 Antibody-IF1
Antibody Target
- Target
- T-lymphocyte activation antigen CD86
- UniProt Number
- P42081
- Target Description
- Receptor involved in the costimulatory signal essential for T-lymphocyte proliferation and interleukin-2 production, by binding CD28 or CTLA-4. May play a critical role in the early events of T-cell activation and costimulation of naive T-cells, such as deciding between immunity and anergy that is made by T-cells within 24 hours after activation. Also involved in the regulation of B cells function, plays a role in regulating the level of IgG(1) produced. Upon CD40 engagement, activates NF-kappa-B signaling pathway via phospholipase C and protein kinase C activation.; FUNCTION: [Isoform 2]: Interferes with the formation of CD86 clusters, and thus acts as a negative regulator of T-cell activation.; FUNCTION: (Microbial infection) Acts as a receptor for adenovirus subgroup B.
- Molecular Weight
- 38kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCFlow CytometryELISA
- Clone
- ARC54011
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human