Antibodies
Anti-CD9 Antibody-Oligo Conjugate
SKU: aoc1603
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-CD9 Antibody-IF1
Antibody Target
- Target
- CD9 antigen
- UniProt Number
- P21926
- Target Description
- Integral membrane protein associated with integrins, which regulates different processes, such as sperm-egg fusion, platelet activation and aggregation, and cell adhesion (PubMed:14575715, PubMed:18541721, PubMed:8478605). Present at the cell surface of oocytes and plays a key role in sperm-egg fusion, possibly by organizing multiprotein complexes and the morphology of the membrane required for the fusion (By similarity). In myoblasts, associates with CD81 and PTGFRN and inhibits myotube fusion during muscle regeneration (By similarity). In macrophages, associates with CD81 and beta-1 and beta-2 integrins, and prevents macrophage fusion into multinucleated giant cells specialized in ingesting complement-opsonized large particles (PubMed:12796480). Also prevents the fusion between mononuclear cell progenitors into osteoclasts in charge of bone resorption (By similarity). Acts as a receptor for PSG17 (By similarity). Involved in platelet activation and aggregation (PubMed:18541721). Regulates paranodal junction formation (By similarity). Involved in cell adhesion, cell motility and tumor metastasis (PubMed:7511626, PubMed:8478605)..
- Molecular Weight
- 25 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIHCFlow CytometryELISA
- Clone
- ARC65641
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human