Antibodies
Anti-CD98 Antibody-Oligo Conjugate
SKU: aoc1610
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-CD98 Antibody-IF1
Antibody Target
- Target
- Amino acid transporter heavy chain SLC3A2
- UniProt Number
- P08195
- Target Description
- Acts as a chaperone that facilitates biogenesis and trafficking of functional transporters heterodimers to the plasma membrane. Forms heterodimer with SLC7 family transporters (SLC7A5, SLC7A6, SLC7A7, SLC7A8, SLC7A10 and SLC7A11), a group of amino-acid antiporters (PubMed:10574970, PubMed:10903140, PubMed:11557028, PubMed:30867591, PubMed:33298890, PubMed:33758168, PubMed:34880232, PubMed:9751058, PubMed:9829974, PubMed:9878049). Heterodimers function as amino acids exchangers, the specificity of the substrate depending on the SLC7A subunit. Heterodimers SLC3A2/SLC7A6 or SLC3A2/SLC7A7 mediate the uptake of dibasic amino acids (PubMed:10903140, PubMed:9829974). Heterodimer SLC3A2/SLC7A11 functions as an antiporter by mediating the exchange of extracellular anionic L-cystine and intracellular L-glutamate across the cellular plasma membrane (PubMed:34880232). SLC3A2/SLC7A10 translocates small neutral L- and D-amino acids across the plasma membrane (By similarity). SLC3A2/SLC75 or SLC3A2/SLC7A8 translocates neutral amino acids with broad specificity, thyroid hormones and L-DOPA (PubMed:10574970, PubMed:11389679, PubMed:11557028, PubMed:11564694, PubMed:11742812, PubMed:12117417, PubMed:12225859, PubMed:12716892, PubMed:15980244, PubMed:30867591, PubMed:33298890, PubMed:33758168). SLC3A2 is essential for plasma membrane localization, stability, and the transport activity of SLC7A5 and SLC7A8 (PubMed:10391915, PubMed:10574970, PubMed:11311135, PubMed:15769744, PubMed:33066406). When associated with LAPTM4B, the heterodimer SLC7A5 is recruited to lysosomes to promote leucine uptake into these organelles, and thereby mediates mTORC1 activation (PubMed:25998567). Modulates integrin-related signaling and is essential for integrin-dependent cell spreading, migration and tumor progression (PubMed:11121428, PubMed:15625115)..; FUNCTION: (Microbial infection) In case of hepatitis C virus/HCV infection, the complex formed by SLC3A2 and SLC7A5/LAT1 plays a role in HCV propagation by facilitating viral entry into host cell and increasing L-leucine uptake-mediated mTORC1 signaling activation, thereby contributing to HCV-mediated pathogenesis..; FUNCTION: (Microbial infection) Acts as a receptor for malaria parasite Plasmodium vivax (Thai isolate) in immature red blood cells..
- Molecular Weight
- 57kDa/61kDa/67kDa/68kDa/71kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCFlow CytometryELISA
- Clone
- ARC64397
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human