Antibodies
Anti-CD98/SLC3A2 Antibody-Oligo Conjugate
SKU: aoc1028
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-CD98/SLC3A2 Antibody-IF1
Antibody Target
- Target
- Amino acid transporter heavy chain SLC3A2
- UniProt Number
- P08195
- Additional Target Information
- This antibody also binds Amino acid transporter heavy chain SLC3A2, Uniprot:P10852.
- Target Description
- Acts as a chaperone that facilitates biogenesis and trafficking of functional transporters heterodimers to the plasma membrane. Forms heterodimer with SLC7 family transporters (SLC7A5, SLC7A6, SLC7A7, SLC7A8, SLC7A10 and SLC7A11), a group of amino-acid antiporters. Heterodimers function as amino acids exchangers, the specificity of the substrate depending on the SLC7A subunit. Heterodimers SLC3A2/SLC7A6 or SLC3A2/SLC7A7 mediate the uptake of dibasic amino acids. Heterodimer SLC3A2/SLC7A11 functions as an antiporter by mediating the exchange of extracellular anionic L-cystine and intracellular L-glutamate across the cellular plasma membrane. SLC3A2/SLC7A10 translocates small neutral L- and D-amino acids across the plasma membrane. SLC3A2/SLC75 or SLC3A2/SLC7A8 translocates neutral amino acids with broad specificity, thyroid hormones and L-DOPA. SLC3A2 is essential for plasma membrane localization, stability, and the transport activity of SLC7A5 and SLC7A8. When associated with LAPTM4B, the heterodimer SLC7A5 is recruited to lysosomes to promote leucine uptake into these organelles, and thereby mediates mTORC1 activation. Modulates integrin-related signaling and is essential for integrin-dependent cell spreading, migration and tumor progression.; FUNCTION: (Microbial infection) In case of hepatitis C virus/HCV infection, the complex formed by SLC3A2 and SLC7A5/LAT1 plays a role in HCV propagation by facilitating viral entry into host cell and increasing L-leucine uptake-mediated mTORC1 signaling activation, thereby contributing to HCV-mediated pathogenesis.; FUNCTION: (Microbial infection) Acts as a receptor for malaria parasite Plasmodium vivax (Thai isolate) in immature red blood cells.
- Molecular Weight
- 58kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human/Mouse
- Host Species
- Rabbit
- Species Reactivity
- HumanRat