Antibodies
Anti-CD98/SLC3A2 Antibody-Oligo Conjugate (ARC79810)
SKU: aoc1611
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-CD98/SLC3A2 Antibody (ARC79810)-IF1
Antibody Target
- Target
- Amino acid transporter heavy chain SLC3A2 (P10852)
- UniProt Number
- P10852
- Molecular Weight
- 58 kDa/62 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIF-PIHCELISA
- Clone
- ARC79810
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Mouse
- Host Species
- Rabbit
- Species Reactivity
- MouseRat