Antibodies
Anti-CD99 Antibody-Oligo Conjugate
SKU: aoc1612
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-CD99 Antibody-IF1
Antibody Target
- Target
- CD99 antigen
- UniProt Number
- P14209
- Target Description
- Involved in T-cell adhesion processes and in spontaneous rosette formation with erythrocytes. Plays a role in a late step of leukocyte extravasation helping leukocytes to overcome the endothelial basement membrane. Acts at the same site as, but independently of, PECAM1. Involved in T-cell adhesion processes (By similarity)..
- Molecular Weight
- 16-19kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIHCFlow CytometryELISA
- Clone
- ARC67259
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human