Antibodies
Anti-Cdc25C Antibody-Oligo Conjugate
SKU: aoc1617
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Cdc25C Antibody-IF1
Antibody Target
- Target
- M-phase inducer phosphatase 3
- UniProt Number
- P30307
- Target Description
- Functions as a dosage-dependent inducer in mitotic control. Tyrosine protein phosphatase required for progression of the cell cycle. When phosphorylated, highly effective in activating G2 cells into prophase. Directly dephosphorylates CDK1 and activates its kinase activity.
- Molecular Weight
- 53kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC0622
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat