Antibodies
Anti-CDC5L Antibody-Oligo Conjugate
SKU: aoc1624
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-CDC5L Antibody-IF1
Antibody Target
- Target
- Cell division cycle 5-like protein
- UniProt Number
- Q99459
- Target Description
- DNA-binding protein involved in cell cycle control. May act as a transcription activator. Plays a role in pre-mRNA splicing as core component of precatalytic, catalytic and postcatalytic spliceosomal complexes (PubMed:11991638, PubMed:20176811, PubMed:28076346, PubMed:28502770, PubMed:29301961, PubMed:29360106, PubMed:29361316, PubMed:30705154, PubMed:30728453). Component of the PRP19-CDC5L complex that forms an integral part of the spliceosome and is required for activating pre-mRNA splicing. The PRP19-CDC5L complex may also play a role in the response to DNA damage (DDR) (PubMed:20176811). As a component of the minor spliceosome, involved in the splicing of U12-type introns in pre-mRNAs (Probable)..
- Molecular Weight
- 92kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC1618
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse