Antibodies

Anti-CDK1/2 Antibody-Oligo Conjugate

SKU: aoc1627

Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.

Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.

Choose AbOliGo for...

  • Consistent conjugation performance
  • Flexible antibody and oligo pairing
  • Fast conjugation turn around time
  • Trusted expertise in oligo design

Choose Oligo Conjugate

Assay

Immunofluorescence Oligossee protocol

IF1 Oligo Details

5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'

View Paper

Accessory oligo is complementary to only the ab-conjugated oligo

Anti-CDK1/2 Antibody-IF1

Antibody Target

Target
Cyclin-dependent kinase 1
UniProt Number
P06493
Additional Target Information
This antibody also binds Cyclin-dependent kinase 2, Uniprot:P24941.
Target Description
Plays a key role in the control of the eukaryotic cell cycle by modulating the centrosome cycle as well as mitotic onset; promotes G2-M transition via association with multiple interphase cyclins. Phosphorylates PARVA/actopaxin, APC, AMPH, APC, BARD1, Bcl-xL/BCL2L1, BRCA2, CALD1, CASP8, CDC7, CDC20, CDC25A, CDC25C, CC2D1A, CENPA, CSNK2 proteins/CKII, FZR1/CDH1, CDK7, CEBPB, CHAMP1, DMD/dystrophin, EEF1 proteins/EF-1, EZH2, KIF11/EG5, EGFR, FANCG, FOS, GFAP, GOLGA2/GM130, GRASP1, UBE2A/hHR6A, HIST1H1 proteins/histone H1, HMGA1, HIVEP3/KRC, KAT5, LMNA, LMNB, LBR, MKI67, LATS1, MAP1B, MAP4, MARCKS, MCM2, MCM4, MKLP1, MLST8, MYB, NEFH, NFIC, NPC/nuclear pore complex, PITPNM1/NIR2, NPM1, NCL, NUCKS1, NPM1/numatrin, ORC1, PRKAR2A, EEF1E1/p18, EIF3F/p47, p53/TP53, NONO/p54NRB, PAPOLA, PLEC/plectin, RB1, TPPP, UL40/R2, RAB4A, RAP1GAP, RBBP8/CtIP, RCC1, RPS6KB1/S6K1, KHDRBS1/SAM68, ESPL1, SKI, BIRC5/survivin, STIP1, TEX14, beta-tubulins, MAPT/TAU, NEDD1, VIM/vimentin, TK1, FOXO1, RUNX1/AML1, SAMHD1, SIRT2, CGAS and RUNX2. CDK1/CDC2-cyclin-B controls pronuclear union in interphase fertilized eggs. Essential for early stages of embryonic development. During G2 and early mitosis, CDC25A/B/C-mediated dephosphorylation activates CDK1/cyclin complexes which phosphorylate several substrates that trigger at least centrosome separation, Golgi dynamics, nuclear envelope breakdown and chromosome condensation. Once chromosomes are condensed and aligned at the metaphase plate, CDK1 activity is switched off by WEE1- and PKMYT1-mediated phosphorylation to allow sister chromatid separation, chromosome decondensation, reformation of the nuclear envelope and cytokinesis. Phosphorylates KRT5 during prometaphase and metaphase. Inactivated by PKR/EIF2AK2- and WEE1-mediated phosphorylation upon DNA damage to stop cell cycle and genome replication at the G2 checkpoint thus facilitating DNA repair. Reactivated after successful DNA repair through WIP1-dependent signaling leading to CDC25A/B/C-mediated dephosphorylation and restoring cell cycle progression. Catalyzes lamin (LMNA, LMNB1 and LMNB2) phosphorylation at the onset of mitosis, promoting nuclear envelope breakdown. In proliferating cells, CDK1-mediated FOXO1 phosphorylation at the G2-M phase represses FOXO1 interaction with 14-3-3 proteins and thereby promotes FOXO1 nuclear accumulation and transcription factor activity, leading to cell death of postmitotic neurons. The phosphorylation of beta-tubulins regulates microtubule dynamics during mitosis. NEDD1 phosphorylation promotes PLK1-mediated NEDD1 phosphorylation and subsequent targeting of the gamma-tubulin ring complex (gTuRC) to the centrosome, an important step for spindle formation. In addition, CC2D1A phosphorylation regulates CC2D1A spindle pole localization and association with SCC1/RAD21 and centriole cohesion during mitosis. The phosphorylation of Bcl-xL/BCL2L1 after prolongated G2 arrest upon DNA damage triggers apoptosis. In contrast, CASP8 phosphorylation during mitosis prevents its activation by proteolysis and subsequent apoptosis. This phosphorylation occurs in cancer cell lines, as well as in primary breast tissues and lymphocytes. EZH2 phosphorylation promotes H3K27me3 maintenance and epigenetic gene silencing. CALD1 phosphorylation promotes Schwann cell migration during peripheral nerve regeneration. CDK1-cyclin-B complex phosphorylates NCKAP5L and mediates its dissociation from centrosomes during mitosis. Regulates the amplitude of the cyclic expression of the core clock gene BMAL1 by phosphorylating its transcriptional repressor NR1D1, and this phosphorylation is necessary for SCF(FBXW7)-mediated ubiquitination and proteasomal degradation of NR1D1. Phosphorylates EML3 at 'Thr-881' which is essential for its interaction with HAUS augmin-like complex and TUBG1. Phosphorylates CGAS during mitosis, leading to its inhibition, thereby preventing CGAS activation by self DNA during mitosis. Phosphorylates SKA3 on multiple sites during mitosis which promotes SKA3 binding to the NDC80 complex and anchoring of the SKA complex to kinetochores, to enable stable attachment of mitotic spindle microtubules to kinetochores.; FUNCTION: (Microbial infection) Acts as a receptor for hepatitis C virus (HCV) in hepatocytes and facilitates its cell entry.
Molecular Weight
34kDa

Antibody Characteristics

Clonality
Monoclonal
Application
WBIF-PIHCELISA
Isotype
IgG
Form
Liquid
Immunogen
Recombinant protein (or fragment).This information is considered to be commercially sensitive.
Immunogen Species
Human
Host Species
Rabbit
Species Reactivity
HumanMouse