Antibodies
Anti-Cdk4 Antibody-Oligo Conjugate (ARC2641)
SKU: aoc1631
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Cdk4 Antibody (ARC2641)-IF1
Antibody Target
- Target
- Cyclin-dependent kinase 4
- UniProt Number
- P11802
- Target Description
- Ser/Thr-kinase component of cyclin D-CDK4 (DC) complexes that phosphorylate and inhibit members of the retinoblastoma (RB) protein family including RB1 and regulate the cell-cycle during G(1)/S transition. Phosphorylation of RB1 allows dissociation of the transcription factor E2F from the RB/E2F complexes and the subsequent transcription of E2F target genes which are responsible for the progression through the G(1) phase. Hypophosphorylates RB1 in early G(1) phase. Cyclin D-CDK4 complexes are major integrators of various mitogenenic and antimitogenic signals. Also phosphorylates SMAD3 in a cell-cycle-dependent manner and represses its transcriptional activity. Component of the ternary complex, cyclin D/CDK4/CDKN1B, required for nuclear translocation and activity of the cyclin D-CDK4 complex.
- Molecular Weight
- 34kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC2641
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat