Antibodies
Anti-Cdk9 Antibody-Oligo Conjugate
SKU: aoc1637
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Cdk9 Antibody-IF1
Antibody Target
- Target
- Cyclin-dependent kinase 9
- UniProt Number
- P50750
- Target Description
- Protein kinase involved in the regulation of transcription (PubMed:10574912, PubMed:10757782, PubMed:11145967, PubMed:11575923, PubMed:11809800, PubMed:11884399, PubMed:14701750, PubMed:16109376, PubMed:16109377, PubMed:20930849, PubMed:28426094, PubMed:29335245). Member of the cyclin-dependent kinase pair (CDK9/cyclin-T) complex, also called positive transcription elongation factor b (P-TEFb), which facilitates the transition from abortive to productive elongation by phosphorylating the CTD (C-terminal domain) of the large subunit of RNA polymerase II (RNAP II) POLR2A, SUPT5H and RDBP (PubMed:10574912, PubMed:10757782, PubMed:11145967, PubMed:11575923, PubMed:11809800, PubMed:11884399, PubMed:14701750, PubMed:16109376, PubMed:16109377, PubMed:16427012, PubMed:20930849, PubMed:28426094, PubMed:30134174). This complex is inactive when in the 7SK snRNP complex form (PubMed:10574912, PubMed:10757782, PubMed:11145967, PubMed:11575923, PubMed:11809800, PubMed:11884399, PubMed:14701750, PubMed:16109376, PubMed:16109377, PubMed:20930849, PubMed:28426094). Phosphorylates EP300, MYOD1, RPB1/POLR2A and AR and the negative elongation factors DSIF and NELFE (PubMed:10912001, PubMed:11112772, PubMed:12037670, PubMed:16427012, PubMed:20081228, PubMed:20980437, PubMed:21127351, PubMed:9857195). Regulates cytokine inducible transcription networks by facilitating promoter recognition of target transcription factors (e.g. TNF-inducible RELA/p65 activation and IL-6-inducible STAT3 signaling) (PubMed:17956865, PubMed:18362169). Promotes RNA synthesis in genetic programs for cell growth, differentiation and viral pathogenesis (PubMed:10393184, PubMed:11112772). P-TEFb is also involved in cotranscriptional histone modification, mRNA processing and mRNA export (PubMed:15564463, PubMed:19575011, PubMed:19844166). Modulates a complex network of chromatin modifications including histone H2B monoubiquitination (H2Bub1), H3 lysine 4 trimethylation (H3K4me3) and H3K36me3; integrates phosphorylation during transcription with chromatin modifications to control co-transcriptional histone mRNA processing (PubMed:15564463, PubMed:19575011, PubMed:19844166). The CDK9/cyclin-K complex has also a kinase activity towards CTD of RNAP II and can substitute for CDK9/cyclin-T P-TEFb in vitro (PubMed:21127351). Replication stress response protein; the CDK9/cyclin-K complex is required for genome integrity maintenance, by promoting cell cycle recovery from replication arrest and limiting single-stranded DNA amount in response to replication stress, thus reducing the breakdown of stalled replication forks and avoiding DNA damage (PubMed:20493174). In addition, probable function in DNA repair of isoform 2 via interaction with KU70/XRCC6 (PubMed:20493174). Promotes cardiac myocyte enlargement (PubMed:20081228). RPB1/POLR2A phosphorylation on 'Ser-2' in CTD activates transcription (PubMed:21127351). AR phosphorylation modulates AR transcription factor promoter selectivity and cell growth. DSIF and NELF phosphorylation promotes transcription by inhibiting their negative effect (PubMed:10912001, PubMed:11112772, PubMed:9857195). The phosphorylation of MYOD1 enhances its transcriptional activity and thus promotes muscle differentiation (PubMed:12037670). Catalyzes phosphorylation of KAT5, promoting KAT5 recruitment to chromatin and histone acetyltransferase activity (PubMed:29335245)..
- Molecular Weight
- 43kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCIPELISA
- Clone
- ARC0527
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat