Antibodies
Anti-Cdk9 Antibody-Oligo Conjugate
SKU: aoc1637
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Cdk9 Antibody-IF1
Antibody Target
- Target
- Cyclin-dependent kinase 9
- UniProt Number
- P50750
- Target Description
- Protein kinase involved in the regulation of transcription. Member of the cyclin-dependent kinase pair (CDK9/cyclin-T) complex, also called positive transcription elongation factor b (P-TEFb), which facilitates the transition from abortive to productive elongation by phosphorylating the CTD (C-terminal domain) of the large subunit of RNA polymerase II (RNAP II) POLR2A, SUPT5H and RDBP. This complex is inactive when in the 7SK snRNP complex form. Phosphorylates EP300, MYOD1, RPB1/POLR2A and AR and the negative elongation factors DSIF and NELFE. Regulates cytokine inducible transcription networks by facilitating promoter recognition of target transcription factors (e.g. TNF-inducible RELA/p65 activation and IL-6-inducible STAT3 signaling). Promotes RNA synthesis in genetic programs for cell growth, differentiation and viral pathogenesis. P-TEFb is also involved in cotranscriptional histone modification, mRNA processing and mRNA export. Modulates a complex network of chromatin modifications including histone H2B monoubiquitination (H2Bub1), H3 lysine 4 trimethylation (H3K4me3) and H3K36me3; integrates phosphorylation during transcription with chromatin modifications to control co-transcriptional histone mRNA processing. The CDK9/cyclin-K complex has also a kinase activity towards CTD of RNAP II and can substitute for CDK9/cyclin-T P-TEFb in vitro. Replication stress response protein; the CDK9/cyclin-K complex is required for genome integrity maintenance, by promoting cell cycle recovery from replication arrest and limiting single-stranded DNA amount in response to replication stress, thus reducing the breakdown of stalled replication forks and avoiding DNA damage. In addition, probable function in DNA repair of isoform 2 via interaction with KU70/XRCC6. Promotes cardiac myocyte enlargement. RPB1/POLR2A phosphorylation on 'Ser-2' in CTD activates transcription. AR phosphorylation modulates AR transcription factor promoter selectivity and cell growth. DSIF and NELF phosphorylation promotes transcription by inhibiting their negative effect. The phosphorylation of MYOD1 enhances its transcriptional activity and thus promotes muscle differentiation. Catalyzes phosphorylation of KAT5, promoting KAT5 recruitment to chromatin and histone acetyltransferase activity.
- Molecular Weight
- 43kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCIPELISA
- Clone
- ARC0527
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat