Antibodies
Anti-CDKN1A/p21 Antibody-Oligo Conjugate
SKU: aoc1030
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-CDKN1A/p21 Antibody-IF1
Antibody Target
- Target
- Cyclin-dependent kinase inhibitor 1
- UniProt Number
- P38936
- Additional Target Information
- This antibody also binds Cyclin-dependent kinase inhibitor 1, Uniprot:P39689.
- Target Description
- Plays an important role in controlling cell cycle progression and DNA damage-induced G2 arrest. Involved in p53/TP53 mediated inhibition of cellular proliferation in response to DNA damage. Also involved in p53-independent DNA damage-induced G2 arrest mediated by CREB3L1 in astrocytes and osteoblasts. Binds to and inhibits cyclin-dependent kinase activity, preventing phosphorylation of critical cyclin-dependent kinase substrates and blocking cell cycle progression. Functions in the nuclear localization and assembly of cyclin D-CDK4 complex and promotes its kinase activity towards RB1. At higher stoichiometric ratios, inhibits the kinase activity of the cyclin D-CDK4 complex. Inhibits DNA synthesis by DNA polymerase delta by competing with POLD3 for PCNA binding. Negatively regulates the CDK4- and CDK6-driven phosphorylation of RB1 in keratinocytes, thereby resulting in the release of E2F1 and subsequent transcription of E2F1-driven G1/S phase promoting genes.
- Molecular Weight
- 18 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human/Mouse
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse