Antibodies
Anti-CDX2 Antibody-Oligo Conjugate
SKU: aoc1641
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-CDX2 Antibody-IF1
Antibody Target
- Target
- Homeobox protein CDX-2
- UniProt Number
- Q99626
- Target Description
- Transcription factor which regulates the transcription of multiple genes expressed in the intestinal epithelium. Binds to the promoter of the intestinal sucrase-isomaltase SI and activates SI transcription. Binds to the DNA sequence 5'-ATAAAAACTTAT-3' in the promoter region of VDR and activates VDR transcription. Binds to and activates transcription of LPH. Activates transcription of CLDN2 and intestinal mucin MUC2. Binds to the 5'-AATTTTTTACAACACCT-3' DNA sequence in the promoter region of CA1 and activates CA1 transcription. Important in broad range of functions from early differentiation to maintenance of the intestinal epithelial lining of both the small and large intestine. Binds preferentially to methylated DNA.
- Molecular Weight
- 34kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIPIF-PIHCELISA
- Clone
- ARC0450
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat