Antibodies
Anti-CENPC Antibody-Oligo Conjugate
SKU: aoc1652
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-CENPC Antibody-IF1
Antibody Target
- Target
- Centromere protein C
- UniProt Number
- Q03188
- Target Description
- Component of the CENPA-NAC (nucleosome-associated) complex, a complex that plays a central role in assembly of kinetochore proteins, mitotic progression and chromosome segregation. The CENPA-NAC complex recruits the CENPA-CAD (nucleosome distal) complex and may be involved in incorporation of newly synthesized CENPA into centromeres. CENPC recruits DNA methylation and DNMT3B to both centromeric and pericentromeric satellite repeats and regulates the histone code in these regions..
- Molecular Weight
- 107kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC2097
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanRat