Antibodies
Anti-Ceruloplasmin Antibody-Oligo Conjugate
SKU: aoc1654
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Ceruloplasmin Antibody-IF1
Antibody Target
- Target
- Ceruloplasmin
- UniProt Number
- P00450
- Target Description
- Multifunctional blue, copper-binding (6-7 atoms per molecule) glycoprotein. It has ferroxidase activity oxidizing Fe(2+) to Fe(3+) without releasing radical oxygen species. It is involved in iron transport across the cell membrane (PubMed:16150804). Copper ions provide a large number of enzymatic activites. Oxidizes highly toxic ferrous ions to the ferric state for further incorporation onto apo-transferrins, catalyzes Cu(+) oxidation and promotes the oxidation of biogenic amines such as norepinephrin and serotonin (PubMed:14623105, PubMed:4643313, PubMed:5912351). Provides Cu(2+) ions for the ascorbate-mediated deaminase degradation of the heparan sulfate chains of GPC1 (By similarity). Has glutathione peroxidase-like activity, can remove both hydrogen peroxide and lipid hydroperoxide in the presence of thiols (PubMed:10481051). Also shows NO-oxidase and NO2 synthase activities that determine endocrine NO homeostasis (PubMed:16906150)..
- Molecular Weight
- 122kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIF-PIHCELISA
- Clone
- ARC5018-06
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat