Antibodies
Anti-CFAP20/GTL3 Antibody-Oligo Conjugate
SKU: aoc1656
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-CFAP20/GTL3 Antibody-IF1
Antibody Target
- Target
- Cilia- and flagella-associated protein 20
- UniProt Number
- Q9Y6A4
- Target Description
- Cilium- and flagellum-specific protein that plays a role in axonemal structure organization and motility (PubMed:24414207). Microtubule inner protein (MIP) part of the dynein-decorated doublet microtubules (DMTs) in cilia axoneme, which is required for motile cilia beating (PubMed:36191189). Involved in the regulation of the size and morphology of cilia (PubMed:24414207). Required for axonemal microtubules polyglutamylation (PubMed:24414207)..
- Molecular Weight
- 23kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC58773
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat