Antibodies
Anti- CHCHD4 Antibody-Oligo Conjugate
SKU: aoc1012
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti- CHCHD4 Antibody-IF1
Antibody Target
- Target
- Mitochondrial intermembrane space import and assembly protein 40
- UniProt Number
- Q8N4Q1
- Target Description
- Central component of a redox-sensitive mitochondrial intermembrane space import machinery which is required for the biogenesis of respiratory chain complexes (PubMed:26004228). Functions as chaperone and catalyzes the formation of disulfide bonds in substrate proteins, such as COX17, COX19, MICU1 and COA7 (PubMed:16185709, PubMed:19182799, PubMed:21059946, PubMed:23186364, PubMed:23676665, PubMed:26387864, PubMed:30885959). Required for the import and folding of small cysteine-containing proteins (small Tim) in the mitochondrial intermembrane space (IMS). Required for the import of COA7 in the IMS (PubMed:30885959). Precursor proteins to be imported into the IMS are translocated in their reduced form into the mitochondria. The oxidized form of CHCHD4/MIA40 forms a transient intermolecular disulfide bridge with the reduced precursor protein, resulting in oxidation of the precursor protein that now contains an intramolecular disulfide bond and is able to undergo folding in the IMS (PubMed:16185709, PubMed:19182799, PubMed:21059946, PubMed:23676665). Reduced CHCHD4/MIA40 is then reoxidized by GFER/ERV1 via a disulfide relay system (PubMed:23186364). Mediates formation of disulfide bond in MICU1 in the IMS, promoting formation of the MICU1-MICU2 heterodimer that regulates mitochondrial calcium uptake (PubMed:26387864)..
- Molecular Weight
- 16kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIF-PIHCELISA
- Clone
- ARC72750
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat