Antibodies

Anti-Chk1 Antibody-Oligo Conjugate

SKU: aoc1667

Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.

Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.

Choose AbOliGo for...

  • Consistent conjugation performance
  • Flexible antibody and oligo pairing
  • Fast conjugation turn around time
  • Trusted expertise in oligo design

Choose Oligo Conjugate

Assay

Immunofluorescence Oligossee protocol

IF1 Oligo Details

5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'

View Paper

Accessory oligo is complementary to only the ab-conjugated oligo

Anti-Chk1 Antibody-IF1

Antibody Target

Target
Serine/threonine-protein kinase Chk1
UniProt Number
O14757
Target Description
Serine/threonine-protein kinase which is required for checkpoint-mediated cell cycle arrest and activation of DNA repair in response to the presence of DNA damage or unreplicated DNA (PubMed:11535615, PubMed:12399544, PubMed:12446774, PubMed:14559997, PubMed:14988723, PubMed:15311285, PubMed:15650047, PubMed:15665856, PubMed:32357935). May also negatively regulate cell cycle progression during unperturbed cell cycles (PubMed:11535615, PubMed:12399544, PubMed:12446774, PubMed:14559997, PubMed:14988723, PubMed:15311285, PubMed:15650047, PubMed:15665856). This regulation is achieved by a number of mechanisms that together help to preserve the integrity of the genome (PubMed:11535615, PubMed:12399544, PubMed:12446774, PubMed:14559997, PubMed:14988723, PubMed:15311285, PubMed:15650047, PubMed:15665856). Recognizes the substrate consensus sequence [R-X-X-S/T] (PubMed:11535615, PubMed:12399544, PubMed:12446774, PubMed:14559997, PubMed:14988723, PubMed:15311285, PubMed:15650047, PubMed:15665856). Binds to and phosphorylates CDC25A, CDC25B and CDC25C (PubMed:12676583, PubMed:12676925, PubMed:12759351, PubMed:14559997, PubMed:14681206, PubMed:19734889, PubMed:9278511). Phosphorylation of CDC25A at 'Ser-178' and 'Thr-507' and phosphorylation of CDC25C at 'Ser-216' creates binding sites for 14-3-3 proteins which inhibit CDC25A and CDC25C (PubMed:9278511). Phosphorylation of CDC25A at 'Ser-76', 'Ser-124', 'Ser-178', 'Ser-279' and 'Ser-293' promotes proteolysis of CDC25A (PubMed:12676583, PubMed:12676925, PubMed:12759351, PubMed:14681206, PubMed:19734889, PubMed:9278511). Phosphorylation of CDC25A at 'Ser-76' primes the protein for subsequent phosphorylation at 'Ser-79', 'Ser-82' and 'Ser-88' by NEK11, which is required for polyubiquitination and degradation of CDCD25A (PubMed:19734889, PubMed:20090422, PubMed:9278511). Inhibition of CDC25 leads to increased inhibitory tyrosine phosphorylation of CDK-cyclin complexes and blocks cell cycle progression (PubMed:9278511). Also phosphorylates NEK6 (PubMed:18728393). Binds to and phosphorylates RAD51 at 'Thr-309', which promotes the release of RAD51 from BRCA2 and enhances the association of RAD51 with chromatin, thereby promoting DNA repair by homologous recombination (PubMed:15665856). Phosphorylates multiple sites within the C-terminus of TP53, which promotes activation of TP53 by acetylation and promotes cell cycle arrest and suppression of cellular proliferation (PubMed:10673501, PubMed:15659650, PubMed:16511572). Also promotes repair of DNA cross-links through phosphorylation of FANCE (PubMed:17296736). Binds to and phosphorylates TLK1 at 'Ser-743', which prevents the TLK1-dependent phosphorylation of the chromatin assembly factor ASF1A (PubMed:12660173, PubMed:12955071). This may enhance chromatin assembly both in the presence or absence of DNA damage (PubMed:12660173, PubMed:12955071). May also play a role in replication fork maintenance through regulation of PCNA (PubMed:18451105). May regulate the transcription of genes that regulate cell-cycle progression through the phosphorylation of histones (By similarity). Phosphorylates histone H3.1 (to form H3T11ph), which leads to epigenetic inhibition of a subset of genes (By similarity). May also phosphorylate RB1 to promote its interaction with the E2F family of transcription factors and subsequent cell cycle arrest (PubMed:17380128). Phosphorylates SPRTN, promoting SPRTN recruitment to chromatin (PubMed:31316063). Reduces replication stress and activates the G2/M checkpoint, by phosphorylating and inactivating PABIR1/FAM122A and promoting the serine/threonine-protein phosphatase 2A-mediated dephosphorylation and stabilization of WEE1 levels and activity (PubMed:33108758)..; FUNCTION: [Isoform 2]: Endogenous repressor of isoform 1, interacts with, and antagonizes CHK1 to promote the S to G2/M phase transition..
Molecular Weight
54kDa

Antibody Characteristics

Clonality
Monoclonal
Application
WBIHCELISA
Clone
ARC0924
Isotype
IgG
Form
Liquid
Immunogen
Synthetic peptide. This information is considered to be commercially sensitive.
Immunogen Species
Human
Host Species
Rabbit
Species Reactivity
Human