Antibodies
Anti-Chk1 Antibody-Oligo Conjugate
SKU: aoc1667
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Chk1 Antibody-IF1
Antibody Target
- Target
- Serine/threonine-protein kinase Chk1
- UniProt Number
- O14757
- Target Description
- Serine/threonine-protein kinase which is required for checkpoint-mediated cell cycle arrest and activation of DNA repair in response to the presence of DNA damage or unreplicated DNA (PubMed:11535615, PubMed:12399544, PubMed:12446774, PubMed:14559997, PubMed:14988723, PubMed:15311285, PubMed:15650047, PubMed:15665856, PubMed:32357935). May also negatively regulate cell cycle progression during unperturbed cell cycles (PubMed:11535615, PubMed:12399544, PubMed:12446774, PubMed:14559997, PubMed:14988723, PubMed:15311285, PubMed:15650047, PubMed:15665856). This regulation is achieved by a number of mechanisms that together help to preserve the integrity of the genome (PubMed:11535615, PubMed:12399544, PubMed:12446774, PubMed:14559997, PubMed:14988723, PubMed:15311285, PubMed:15650047, PubMed:15665856). Recognizes the substrate consensus sequence [R-X-X-S/T] (PubMed:11535615, PubMed:12399544, PubMed:12446774, PubMed:14559997, PubMed:14988723, PubMed:15311285, PubMed:15650047, PubMed:15665856). Binds to and phosphorylates CDC25A, CDC25B and CDC25C (PubMed:12676583, PubMed:12676925, PubMed:12759351, PubMed:14559997, PubMed:14681206, PubMed:19734889, PubMed:9278511). Phosphorylation of CDC25A at 'Ser-178' and 'Thr-507' and phosphorylation of CDC25C at 'Ser-216' creates binding sites for 14-3-3 proteins which inhibit CDC25A and CDC25C (PubMed:9278511). Phosphorylation of CDC25A at 'Ser-76', 'Ser-124', 'Ser-178', 'Ser-279' and 'Ser-293' promotes proteolysis of CDC25A (PubMed:12676583, PubMed:12676925, PubMed:12759351, PubMed:14681206, PubMed:19734889, PubMed:9278511). Phosphorylation of CDC25A at 'Ser-76' primes the protein for subsequent phosphorylation at 'Ser-79', 'Ser-82' and 'Ser-88' by NEK11, which is required for polyubiquitination and degradation of CDCD25A (PubMed:19734889, PubMed:20090422, PubMed:9278511). Inhibition of CDC25 leads to increased inhibitory tyrosine phosphorylation of CDK-cyclin complexes and blocks cell cycle progression (PubMed:9278511). Also phosphorylates NEK6 (PubMed:18728393). Binds to and phosphorylates RAD51 at 'Thr-309', which promotes the release of RAD51 from BRCA2 and enhances the association of RAD51 with chromatin, thereby promoting DNA repair by homologous recombination (PubMed:15665856). Phosphorylates multiple sites within the C-terminus of TP53, which promotes activation of TP53 by acetylation and promotes cell cycle arrest and suppression of cellular proliferation (PubMed:10673501, PubMed:15659650, PubMed:16511572). Also promotes repair of DNA cross-links through phosphorylation of FANCE (PubMed:17296736). Binds to and phosphorylates TLK1 at 'Ser-743', which prevents the TLK1-dependent phosphorylation of the chromatin assembly factor ASF1A (PubMed:12660173, PubMed:12955071). This may enhance chromatin assembly both in the presence or absence of DNA damage (PubMed:12660173, PubMed:12955071). May also play a role in replication fork maintenance through regulation of PCNA (PubMed:18451105). May regulate the transcription of genes that regulate cell-cycle progression through the phosphorylation of histones (By similarity). Phosphorylates histone H3.1 (to form H3T11ph), which leads to epigenetic inhibition of a subset of genes (By similarity). May also phosphorylate RB1 to promote its interaction with the E2F family of transcription factors and subsequent cell cycle arrest (PubMed:17380128). Phosphorylates SPRTN, promoting SPRTN recruitment to chromatin (PubMed:31316063). Reduces replication stress and activates the G2/M checkpoint, by phosphorylating and inactivating PABIR1/FAM122A and promoting the serine/threonine-protein phosphatase 2A-mediated dephosphorylation and stabilization of WEE1 levels and activity (PubMed:33108758)..; FUNCTION: [Isoform 2]: Endogenous repressor of isoform 1, interacts with, and antagonizes CHK1 to promote the S to G2/M phase transition..
- Molecular Weight
- 54kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC0924
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human