Antibodies
Anti-CHMP2B Antibody-Oligo Conjugate
SKU: aoc1670
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-CHMP2B Antibody-IF1
Antibody Target
- Target
- Charged multivesicular body protein 2b
- UniProt Number
- Q9UQN3
- Target Description
- Probable core component of the endosomal sorting required for transport complex III (ESCRT-III) which is involved in multivesicular bodies (MVBs) formation and sorting of endosomal cargo proteins into MVBs. MVBs contain intraluminal vesicles (ILVs) that are generated by invagination and scission from the limiting membrane of the endosome and mostly are delivered to lysosomes enabling degradation of membrane proteins, such as stimulated growth factor receptors, lysosomal enzymes and lipids. The MVB pathway appears to require the sequential function of ESCRT-O, -I,-II and -III complexes. ESCRT-III proteins mostly dissociate from the invaginating membrane before the ILV is released. The ESCRT machinery also functions in topologically equivalent membrane fission events, such as the terminal stages of cytokinesis and the budding of enveloped viruses (HIV-1 and other lentiviruses). ESCRT-III proteins are believed to mediate the necessary vesicle extrusion and/or membrane fission activities, possibly in conjunction with the AAA ATPase VPS4.
- Molecular Weight
- 24kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC2404
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat