Antibodies
Anti-CHOP Antibody-Oligo Conjugate
SKU: aoc1671
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-CHOP Antibody-IF1
Antibody Target
- Target
- DNA damage-inducible transcript 3 protein
- UniProt Number
- P35638
- Target Description
- Multifunctional transcription factor in endoplasmic reticulum (ER) stress response. Plays an essential role in the response to a wide variety of cell stresses and induces cell cycle arrest and apoptosis in response to ER stress. Plays a dual role both as an inhibitor of CCAAT/enhancer-binding protein (C/EBP) function and as an activator of other genes. Acts as a dominant-negative regulator of C/EBP-induced transcription: dimerizes with members of the C/EBP family, impairs their association with C/EBP binding sites in the promoter regions, and inhibits the expression of C/EBP regulated genes. Positively regulates the transcription of TRIB3, IL6, IL8, IL23, TNFRSF10B/DR5, PPP1R15A/GADD34, BBC3/PUMA, BCL2L11/BIM and ERO1L. Negatively regulates; expression of BCL2 and MYOD1, ATF4-dependent transcriptional activation of asparagine synthetase (ASNS), CEBPA-dependent transcriptional activation of hepcidin (HAMP) and CEBPB-mediated expression of peroxisome proliferator-activated receptor gamma (PPARG). Together with ATF4, mediates ER-mediated cell death by promoting expression of genes involved in cellular amino acid metabolic processes, mRNA translation and the unfolded protein response (UPR) in response to ER stress. Inhibits the canonical Wnt signaling pathway by binding to TCF7L2/TCF4, impairing its DNA-binding properties and repressing its transcriptional activity. Plays a regulatory role in the inflammatory response through the induction of caspase-11 (CASP4/CASP11) which induces the activation of caspase-1 (CASP1) and both these caspases increase the activation of pro-IL1B to mature IL1B which is involved in the inflammatory response. Acts as a major regulator of postnatal neovascularization through regulation of endothelial nitric oxide synthase (NOS3)-related signaling.
- Molecular Weight
- 19 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC51417
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat