Antibodies
Anti-Chromogranin A Antibody-Oligo Conjugate
SKU: aoc1672
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Chromogranin A Antibody-IF1
Antibody Target
- Target
- Chromogranin-A
- UniProt Number
- P10645
- Target Description
- [Pancreastatin]: Strongly inhibits glucose induced insulin release from the pancreas.; FUNCTION: [Catestatin]: Inhibits catecholamine release from chromaffin cells and noradrenergic neurons by acting as a non-competitive nicotinic cholinergic antagonist (PubMed:15326220). Displays antibacterial activity against Gram-positive bacteria S.aureus and M.luteus, and Gram-negative bacteria E.coli and P.aeruginosa (PubMed:15723172, PubMed:24723458). Can induce mast cell migration, degranulation and production of cytokines and chemokines (PubMed:21214543). Acts as a potent scavenger of free radicals in vitro (PubMed:24723458). May play a role in the regulation of cardiac function and blood pressure (PubMed:18541522)..; FUNCTION: [Serpinin]: Regulates granule biogenesis in endocrine cells by up-regulating the transcription of protease nexin 1 (SERPINE2) via a cAMP-PKA-SP1 pathway. This leads to inhibition of granule protein degradation in the Golgi complex which in turn promotes granule formation..
- Molecular Weight
- 51kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- IF-PIHCELISA
- Clone
- ARC1643
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat