Antibodies
Anti-CIRBP Antibody-Oligo Conjugate
SKU: aoc1677
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-CIRBP Antibody-IF1
Antibody Target
- Target
- Cold-inducible RNA-binding protein
- UniProt Number
- Q14011
- Target Description
- Cold-inducible mRNA binding protein that plays a protective role in the genotoxic stress response by stabilizing transcripts of genes involved in cell survival. Acts as a translational activator. Seems to play an essential role in cold-induced suppression of cell proliferation. Binds specifically to the 3'-untranslated regions (3'-UTRs) of stress-responsive transcripts RPA2 and TXN. Acts as a translational repressor. Promotes assembly of stress granules (SGs), when overexpressed.
- Molecular Weight
- 19kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIPIF-PIHCELISA
- Clone
- ARC2472
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human