Antibodies
Anti-Claudin 1 Antibody-Oligo Conjugate
SKU: aoc1683
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Claudin 1 Antibody-IF1
Antibody Target
- Target
- Claudin-1
- UniProt Number
- O95832
- Target Description
- Claudins function as major constituents of the tight junction complexes that regulate the permeability of epithelia. While some claudin family members play essential roles in the formation of impermeable barriers, others mediate the permeability to ions and small molecules. Often, several claudin family members are coexpressed and interact with each other, and this determines the overall permeability. CLDN1 is required to prevent the paracellular diffusion of small molecules through tight junctions in the epidermis and is required for the normal barrier function of the skin. Required for normal water homeostasis and to prevent excessive water loss through the skin, probably via an indirect effect on the expression levels of other proteins, since CLDN1 itself seems to be dispensable for water barrier formation in keratinocyte tight junctions.; FUNCTION: (Microbial infection) Acts as a co-receptor for hepatitis C virus (HCV) in hepatocytes. Associates with CD81 and the CLDN1-CD81 receptor complex is essential for HCV entry into host cell. Acts as a receptor for dengue virus.
- Molecular Weight
- 23kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIPIF-PIHCELISA
- Clone
- ARC3289
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat