Antibodies
Anti-Claudin 4 Antibody-Oligo Conjugate
SKU: aoc1685
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Proximity Ligation Assay Oligossee protocol
PLA1 Oligo Details
5'
[AmC6dT] ACAACAACAAGAATGGAACCTCGCTAGAACGT
3'
An AOC with the PLA2 oligo is needed to complete the pairing in a Proximity Ligation Assay.
Anti-Claudin 4 Antibody-PLA1
Antibody Target
- Target
- Claudin-4
- UniProt Number
- O14493
- Target Description
- Can associate with other claudins to regulate tight junction structural and functional strand dynamics (PubMed:35773259, PubMed:36008380). May coassemble with CLDN8 into tight junction strands containing anion-selective channels that convey paracellular chloride permeability in renal collecting ducts (By similarity) (PubMed:36008380). May integrate into CLDN3 strands to modulate localized tight junction barrier properties (PubMed:35773259, PubMed:36008380). May disrupt strand assembly of channel-forming CLDN2 and CLDN15 and inhibit cation conductance (PubMed:35773259, PubMed:36008380). Cannot form tight junction strands on its own (PubMed:35773259, PubMed:36008380)..
- Molecular Weight
- 22kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIPELISA
- Clone
- ARC61052
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human