Antibodies
Anti-Claudin18.2 Antibody-Oligo Conjugate (ARC5062-02)
SKU: aoc1688
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Claudin18.2 Antibody (ARC5062-02)-IF1
Antibody Target
- Target
- Claudin-18
- UniProt Number
- P56856
- Target Description
- Involved in alveolar fluid homeostasis via regulation of alveolar epithelial tight junction composition and therefore ion transport and solute permeability, potentially via downstream regulation of the actin cytoskeleton organization and beta-2-adrenergic signaling. Required for lung alveolarization and maintenance of the paracellular alveolar epithelial barrier. Acts to maintain epithelial progenitor cell proliferation and organ size, via regulation of YAP1 localization away from the nucleus and thereby restriction of YAP1 target gene transcription. Acts as a negative regulator of RANKL-induced osteoclast differentiation, potentially via relocation of TJP2/ZO-2 away from the nucleus, subsequently involved in bone resorption in response to calcium deficiency. Mediates the osteoprotective effects of estrogen, potentially via acting downstream of estrogen signaling independently of RANKL signaling pathways.; FUNCTION: [Isoform A1]: Involved in the maintenance of homeostasis of the alveolar microenvironment via regulation of pH and subsequent T-cell activation in the alveolar space, is therefore indirectly involved in limiting C.neoformans infection.; FUNCTION: [Isoform A2]: Required for the formation of the gastric paracellular barrier via its role in tight junction formation, thereby involved in the response to gastric acidification.
- Molecular Weight
- 28kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- IHCELISA
- Clone
- ARC5062-02
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human