Antibodies
Anti-CLPP Antibody-Oligo Conjugate
SKU: aoc1693
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-CLPP Antibody-IF1
Antibody Target
- Target
- ATP-dependent Clp protease proteolytic subunit, mitochondrial
- UniProt Number
- Q16740
- Target Description
- Protease component of the ClpXP complex that cleaves peptides and various proteins in an ATP-dependent process. Has low peptidase activity in the absence of CLPX. The ClpXP complex can degrade CSN1S1, CSN2 and CSN3, as well as synthetic peptides (in vitro) and may be responsible for a fairly general and central housekeeping function rather than for the degradation of specific substrates (PubMed:11923310, PubMed:15522782). Cleaves PINK1 in the mitochondrion (PubMed:22354088)..
- Molecular Weight
- 30kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC1929
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat