Antibodies
Anti-Clusterin Antibody-Oligo Conjugate
SKU: aoc1696
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Clusterin Antibody-IF1
Antibody Target
- Target
- Clusterin
- UniProt Number
- P10909
- Target Description
- [Isoform 1]: Functions as extracellular chaperone that prevents aggregation of non native proteins. Prevents stress-induced aggregation of blood plasma proteins. Inhibits formation of amyloid fibrils by APP, APOC2, B2M, CALCA, CSN3, SNCA and aggregation-prone LYZ variants (in vitro). Does not require ATP. Maintains partially unfolded proteins in a state appropriate for subsequent refolding by other chaperones, such as HSPA8/HSC70. Does not refold proteins by itself. Binding to cell surface receptors triggers internalization of the chaperone-client complex and subsequent lysosomal or proteasomal degradation. Protects cells against apoptosis and against cytolysis by complement: inhibits assembly of the complement membrane attack complex (MAC) by preventing polymerization of C9 pore component of the MAC complex. Intracellular forms interact with ubiquitin and SCF (SKP1-CUL1-F-box protein) E3 ubiquitin-protein ligase complexes and promote the ubiquitination and subsequent proteasomal degradation of target proteins. Promotes proteasomal degradation of COMMD1 and IKBKB. Modulates NF-kappa-B transcriptional activity. A mitochondrial form suppresses BAX-dependent release of cytochrome c into the cytoplasm and inhibit apoptosis. Plays a role in the regulation of cell proliferation. An intracellular form suppresses stress-induced apoptosis by stabilizing mitochondrial membrane integrity through interaction with HSPA5. Secreted form does not affect caspase or BAX-mediated intrinsic apoptosis and TNF-induced NF-kappa-B-activity. Secreted form act as an important modulator during neuronal differentiation through interaction with STMN3. Plays a role in the clearance of immune complexes that arise during cell injury.; FUNCTION: [Isoform 6]: Does not affect caspase or BAX-mediated intrinsic apoptosis and TNF-induced NF-kappa-B-activity.; FUNCTION: [Isoform 4]: Does not affect caspase or BAX-mediated intrinsic apoptosis and TNF-induced NF-kappa-B-activity. Promotes cell death through interaction with BCL2L1 that releases and activates BAX.
- Molecular Weight
- 52kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC52367
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse