Antibodies
Anti-CNBP Antibody-Oligo Conjugate
SKU: aoc1700
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-CNBP Antibody-IF1
Antibody Target
- Target
- CCHC-type zinc finger nucleic acid binding protein
- UniProt Number
- P62633
- Target Description
- Single-stranded DNA-binding protein that preferentially binds to the sterol regulatory element (SRE) sequence 5'-GTGCGGTG-3', and thereby mediates transcriptional repression. Has a role as transactivator of the Myc promoter. Binds single-stranded RNA in a sequence-specific manner.; FUNCTION: [Isoform 1]: Binds G-rich elements in target mRNA coding sequences. Prevents G-quadruplex structure formation in vitro, suggesting a role in supporting translation by resolving stable structures on mRNAs.; FUNCTION: [Isoform 2]: Binds to RNA.; FUNCTION: [Isoform 4]: Binds to RNA.; FUNCTION: [Isoform 5]: Binds to RNA.; FUNCTION: [Isoform 6]: Binds to RNA.; FUNCTION: [Isoform 8]: Binds to RNA.
- Molecular Weight
- 18-20 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC76341
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat