Antibodies
Anti-Complement factor B (CFB) Antibody-Oligo Conjugate
SKU: aoc1718
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Complement factor B (CFB) Antibody-IF1
Antibody Target
- Target
- Complement factor B
- UniProt Number
- P00751
- Target Description
- Precursor of the catalytic component of the C3 and C5 convertase complexes of the alternative pathway of the complement system, a cascade of proteins that leads to phagocytosis and breakdown of pathogens and signaling that strengthens the adaptive immune system. The alternative complement pathway acts as an amplification loop that enhances other complement pathways (classical, lectin and GZMK) by promoting formation of additional C3 and C5 convertases. CFB is cleaved and activated by CFD to generate Ba and Bb chains; Bb chain constituting the catalytic component of the C3 and C5 convertases.; FUNCTION: [Complement factor B Bb]: Serine protease component of the complement C3 and C5 convertase complexes of the alternative complement pathway. Following cleavage and activation by factor D (CFD), forms the C3 convertase together with complement C3b. As part of the C3 convertase, cleaves and activates C3 into C3a anaphylatoxin and C3b opsonin, the next components of the complement pathways. When an additional complement C3b molecule binds to the C3 convertase, forms the C5 convertase, which cleaves and activates C5 into C5a anaphylatoxin and C5b component of the membrane attack complex.; FUNCTION: [Complement factor B Ba]: Involved in proliferation and differentiation of preactivated B-lymphocytes, rapid spreading of peripheral blood monocytes, stimulation of lymphocyte blastogenesis and lysis of erythrocytes.
- Molecular Weight
- 86kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC54100
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse