Antibodies
Anti-CoREST Antibody-Oligo Conjugate
SKU: aoc1725
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-CoREST Antibody-IF1
Antibody Target
- Target
- REST corepressor 1
- UniProt Number
- Q9UKL0
- Target Description
- Essential component of the BHC complex, a corepressor complex that represses transcription of neuron-specific genes in non-neuronal cells. The BHC complex is recruited at RE1/NRSE sites by REST and acts by deacetylating and demethylating specific sites on histones, thereby acting as a chromatin modifier. In the BHC complex, it serves as a molecular beacon for the recruitment of molecular machinery, including MeCP2 and SUV39H1, that imposes silencing across a chromosomal interval. Plays a central role in demethylation of Lys-4 of histone H3 by promoting demethylase activity of KDM1A on core histones and nucleosomal substrates. It also protects KDM1A from the proteasome. Component of a RCOR/GFI/KDM1A/HDAC complex that suppresses, via histone deacetylase (HDAC) recruitment, a number of genes implicated in multilineage blood cell development and controls hematopoietic differentiation..
- Molecular Weight
- 53kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCIPELISAChIP
- Clone
- ARC2044
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat