Antibodies
Anti-Cortactin Antibody-Oligo Conjugate
SKU: aoc1726
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Cortactin Antibody-IF1
Antibody Target
- Target
- Src substrate cortactin
- UniProt Number
- Q14247
- Target Description
- Contributes to the organization of the actin cytoskeleton and cell shape (PubMed:21296879). Plays a role in the formation of lamellipodia and in cell migration. Plays a role in the regulation of neuron morphology, axon growth and formation of neuronal growth cones (By similarity). Through its interaction with CTTNBP2, involved in the regulation of neuronal spine density (By similarity). Plays a role in focal adhesion assembly and turnover (By similarity). In complex with ABL1 and MYLK regulates cortical actin-based cytoskeletal rearrangement critical to sphingosine 1-phosphate (S1P)-mediated endothelial cell (EC) barrier enhancement (PubMed:20861316). Plays a role in intracellular protein transport and endocytosis, and in modulating the levels of potassium channels present at the cell membrane (PubMed:17959782). Plays a role in receptor-mediated endocytosis via clathrin-coated pits (By similarity). Required for stabilization of KCNH1 channels at the cell membrane (PubMed:23144454). Plays a role in the invasiveness of cancer cells, and the formation of metastases (PubMed:16636290)..
- Molecular Weight
- 62kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIPIF-PIHCELISA
- Clone
- ARC1613
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat