Antibodies
Anti-COX7A1 Antibody-Oligo Conjugate
SKU: aoc1735
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-COX7A1 Antibody-IF1
Antibody Target
- Target
- Cytochrome c oxidase subunit 7A1, mitochondrial
- UniProt Number
- P24310
- Target Description
- Component of the mitochondrial respiratory complex IV (CIV, also named cytochrome c oxidase complex), the last enzyme in the mitochondrial electron transport chain which drives oxidative phosphorylation. The CIV complex is the component of the respiratory chain that catalyzes the reduction of oxygen to water. Acts as an assembly factor that specifically drives the homodimerization of CIV complexes, mediating the formation of mitochondrial respiratory supercomplexes (respirasomes) containing two CIV: supercomplxes with two molecules of CIV show improved activity. Despite being highly expressed in brown adipose tissue, not required for thermogenesis.
- Molecular Weight
- 9kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIF-PIHCELISA
- Clone
- ARC53426
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat