Antibodies
Anti-COX7A2L Antibody-Oligo Conjugate
SKU: aoc1736
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-COX7A2L Antibody-IF1
Antibody Target
- Target
- Cytochrome c oxidase subunit 7A2-like, mitochondrial
- UniProt Number
- O14548
- Target Description
- Assembly factor that mediates the formation of some mitochondrial respiratory supercomplexes (respirasomes), thereby promoting oxidative phosphorylation and energy metabolism (PubMed:27545886, PubMed:30428348, PubMed:33727070, PubMed:36198313). Acts as a molecular adapter that associates with both mitochondrial respiratory complexes III (CIII) and IV (CIV), promoting their association (PubMed:27545886, PubMed:36198313). Mediates the formation of various mitochondrial respiratory supercomplexes, such as MCIII(2)IV(2), composed of two CIII and two CIV, and the CS-respirasome (MCI(1)III(2)IV(2)), composed of one CI, two CIII and two CIV (PubMed:27545886, PubMed:30428348). Not involved in the formation of the canonical respirasome (MCI(1)III(2)IV(1)), composed of one CI, two CIII and one CIV (By similarity). The formation of different respirasomes is important for cell adaptation to oxygen conditions and prevent metabolic exhaustion: supercomplexes mediated by COX7A2L/SCAF1 are required to maintain oxidative phosphorylation upon low oxygen conditions and promote metabolic rewiring toward glycolysis (PubMed:36198313)..
- Molecular Weight
- 13kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC65983
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat